View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16829_low_15 (Length: 252)
Name: NF16829_low_15
Description: NF16829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16829_low_15 |
 | |
|
| [»] scaffold0095 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0095 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: scaffold0095
Description:
Target: scaffold0095; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 27028 - 26822
Alignment:
| Q |
1 |
tatgtagctttctccggcgttcaaatggccggcgggggatccgatccgagttggagaacgttggagccgttgaaaagcatcggtggagtgccactgtttt |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| || ||||||||||| |||||| |
|
|
| T |
27028 |
tatgtagctttctccggctttcaaatggccggcgggggatccgatccgagttggagaacgttggagcctttggaaagtattggtggagtgccgttgtttt |
26929 |
T |
|
| Q |
101 |
cgaggcatcggaata---aagaggaggagccggtgaaggttcattccgggatcttgaatctcttttcttcccttttcaactcaatccaaaaccaggtttg |
197 |
Q |
| |
|
||| || |||||||| ||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26928 |
cgacgcgtcggaataaggaagaggaggagccggtgaaggttcactccgggatgttgaatctcttttcttcccttttcaactcaatccaaaaccaggtttg |
26829 |
T |
|
| Q |
198 |
tttattt |
204 |
Q |
| |
|
||||||| |
|
|
| T |
26828 |
tttattt |
26822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 39403070 - 39402864
Alignment:
| Q |
1 |
tatgtagctttctccggcgttcaaatggccggcgggggatccgatccgagttggagaacgttggagccgttgaaaagcatcggtggagtgccactgtttt |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| || ||||||||||| |||||| |
|
|
| T |
39403070 |
tatgtagctttctccggctttcaaatggccggcgggggatccgatccgagttggagaacgttggagcctttggaaagtattggtggagtgccgttgtttt |
39402971 |
T |
|
| Q |
101 |
cgaggcatcggaata---aagaggaggagccggtgaaggttcattccgggatcttgaatctcttttcttcccttttcaactcaatccaaaaccaggtttg |
197 |
Q |
| |
|
||| || |||||||| ||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39402970 |
cgacgcgtcggaataaggaagaggaggagccggtgaaggttcactccgggatgttgaatctcttttcttcccttttcaactcaatccaaaaccaggtttg |
39402871 |
T |
|
| Q |
198 |
tttattt |
204 |
Q |
| |
|
||||||| |
|
|
| T |
39402870 |
tttattt |
39402864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University