View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16829_low_5 (Length: 356)
Name: NF16829_low_5
Description: NF16829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16829_low_5 |
 |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0007 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 53 - 356
Target Start/End: Complemental strand, 154021 - 153718
Alignment:
| Q |
53 |
agtcgactgaagttgtaacaagtgatgataacaatccgctgcagttggtctttgttctggattctgttccatacaccaattctgtaactctcttaacatc |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
154021 |
agtcgactgaagttgtaacaagtgatgataacaatccgctgcagttggtctttgttctggattctgttccatacaccaattctgtaactctcttaacatc |
153922 |
T |
 |
| Q |
153 |
tttggcacattcaccaacccacatgtcattatcaaatacccaacactccatacatctactttcacaccatgtaatccacgctccatttctggcgcgtgtc |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
153921 |
tttggcacattcaccaacccacatgtcattatcaaatacccaacactccacacatcaactttcacaccatgcaatccacgctccatttctggcgcgtgtc |
153822 |
T |
 |
| Q |
253 |
ttccacgctccaccataccaccttcatgattctcctttacatatttccctaactccggcgcaccggccgcttcgtcgaaaccactcacaaaccattctcc |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
153821 |
ttccacgctccaccataccaccttcatgattatcctttacatatttccctagctccggcgctccggccgcttcgtcgaaaccactcacaaaccattctcc |
153722 |
T |
 |
| Q |
353 |
tcct |
356 |
Q |
| |
|
|||| |
|
|
| T |
153721 |
tcct |
153718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University