View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16829_low_8 (Length: 330)
Name: NF16829_low_8
Description: NF16829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16829_low_8 |
 | |
|
| [»] scaffold0007 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0007 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 17 - 330
Target Start/End: Original strand, 153295 - 153608
Alignment:
| Q |
17 |
aggaccatgttttagaattggtattttattatcaatgttaagcaaagcttgttccaacatgcaaaagggtagttttgtttatagtgatttcgaaaggtat |
116 |
Q |
| |
|
|||||||||||||||||| || ||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
153295 |
aggaccatgttttagaatcggcattttgttatctatgttaagcaaagcttgttccaacatgcaaaagggtagttttgtctatagtgatttcgaaaggtat |
153394 |
T |
|
| Q |
117 |
agtttcggtcacggtgttataattgaaatgacaccaaacacatgcaaaagggtatttttggaaaagagaaaattctcatcagtgaaagaagtttacgaga |
216 |
Q |
| |
|
||||| ||||| |||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
153395 |
agttttggtcaaggtgttttaatcgaaatgacaccaaacacatgcaaaagggtatttttggaaaagagaaaattctcatcagtgaaagaagtttacgaga |
153494 |
T |
|
| Q |
217 |
tattagatcatagaataccacatagtgagtatttagtcaaagttcttgaaaacaacatgagtttggtatttaaacctagaggaataagagcaaaaccctt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
153495 |
tattagatcatagaataccacatagtgagtatttagtcaaagttcttgaaaacaacatgagtttggtatttaaacctagaggaataagagcaaaaccctt |
153594 |
T |
|
| Q |
317 |
gatcattgaacaac |
330 |
Q |
| |
|
| ||||||||||| |
|
|
| T |
153595 |
aaacattgaacaac |
153608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University