View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1682_low_2 (Length: 436)
Name: NF1682_low_2
Description: NF1682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1682_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 400; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 400; E-Value: 0
Query Start/End: Original strand, 18 - 425
Target Start/End: Complemental strand, 40107309 - 40106902
Alignment:
| Q |
18 |
gattatgtttcgtctctcggaacttacttgggttgcgtcgaaggcttcaatttccacgcttttcctactctgaaccagctttcattagtttctgaacagc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40107309 |
gattatgtttcgtctctcggaacttacttgggttgcgtcgaaggcttcgatttccacgcttttcctactctgaaccagctttcattagtttctgaacagc |
40107210 |
T |
 |
| Q |
118 |
aactaagagacgctggttttggttacaggttagtttaggtttagttccttcaataactgttattagtttcgtgtgaatgttaacgtggttactattttct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40107209 |
aactaagagacgctggttttggttacaggttagtttaggtttagttccttcaataactgttattagtttcgtgtgaatgttaacgtggttactattttct |
40107110 |
T |
 |
| Q |
218 |
tgatagggctaagtatataactggcactgtgaatgttttgcaatcaaaacctgaaggtggggaagaatggctttattctcttcgcaaattggagcttgaa |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40107109 |
tgatagggctaagtatataactggcactgtgaatgttttgcaatcaaaacctgaaggtggggaagaatggctttattctcttcgcaaattggagcttgaa |
40107010 |
T |
 |
| Q |
318 |
gatgtaatatctgaactcatcaagttacctggagtgggtcctaaagtggctgcttgtatagctctttactcacttgatcaacaccatgcaattcctgttg |
417 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40107009 |
gatgtaatatccgaactcatcaagttacctggagtgggtcctaaagtggctgcttgtatagctctttactcacttgatcaacaccatgcaattcctgttg |
40106910 |
T |
 |
| Q |
418 |
atgttcat |
425 |
Q |
| |
|
|||||||| |
|
|
| T |
40106909 |
atgttcat |
40106902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University