View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1683-Insertion-3 (Length: 478)
Name: NF1683-Insertion-3
Description: NF1683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1683-Insertion-3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 214 - 476
Target Start/End: Complemental strand, 5199797 - 5199536
Alignment:
| Q |
214 |
cgaatatggaattgacaaagtctgcacnnnnnnnnnngtctattcgtaaaatttcattgtctctctctgacaaagatgtagcaagctgctttcaccatct |
313 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5199797 |
cgaatatggaattgacaaagtctgcacttttttttt-gtctattcgtaaaatttcattgtctctctctgacaaagatgtagcaagctgctttcaccatct |
5199699 |
T |
|
| Q |
314 |
ctagtgtctagcaatatgcttttactcgaagccactagttaaatgcatatataaaagaacttcacttatcttcaatgctaatttatgaaaatttattata |
413 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5199698 |
ctagtgtctagcaatatgcttttactcgaagccactagttaaatgcatatataaaagaacttcacttatcttcaatgctaatttatgaaaatttattata |
5199599 |
T |
|
| Q |
414 |
tgcatgcatcacatgatgctttccttttcttcttctannnnnnnatttattaaagatgctttc |
476 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5199598 |
tgcatgcatcacatgatgctttccttttcttcttctatttttttatttattaaagatgctttc |
5199536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 8 - 161
Target Start/End: Complemental strand, 5200005 - 5199852
Alignment:
| Q |
8 |
tggtgtagacgtgacagagatagaatctttgcatgaattgttgtttgattaaaaatagaaagatgtgatgtaataacatagtggaatctgattcattgga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5200005 |
tggtgtagacgtgacagagatagaatctttgcatgaattgttgtttgattaaaaatagaaagatgtaatgtaataacatagtggaatctgattcattgga |
5199906 |
T |
|
| Q |
108 |
atttggaagtagccttcaaacataaacctctttccccttcatttacctatcttt |
161 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
5199905 |
atttggaagtagccttcaaatataaacctctttccccttcatttacctagcttt |
5199852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University