View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16832_high_15 (Length: 391)
Name: NF16832_high_15
Description: NF16832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16832_high_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 356; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 4 - 375
Target Start/End: Complemental strand, 5697678 - 5697307
Alignment:
| Q |
4 |
atgaatgcaacaaataattcctaaatgagcaaataatttttgaagttctgcccatcagaattatcccttagaggcaatgtttcgtggtgagatttgcaac |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5697678 |
atgaatgcaacaaataattcctaaatgagcaaataatttttgaagttctgcccatcagaattatcccttagaggcaatgtttcgtggggagatttgcaac |
5697579 |
T |
 |
| Q |
104 |
tggaaaacatattataaactccttgggatagcaaaaatcgttgagtgggttgaaataggggaaatgagagaaattatggattgctcttgataaacaattg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5697578 |
tggaaaacatattataaactccttgggatagcaaaaatcgttgagtgggttgaattaggggaaatgagagaaattatggattgctcttggtaaacaattg |
5697479 |
T |
 |
| Q |
204 |
aggataatttattggttaatttttgtaactctcttgttcttgatataaaaggttagggtggaaattagggtttgcttatgttgatctcatttatggatcc |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5697478 |
aggataatttattggttaatttttgtaactctcttgttcttgatataaaaggttagggtggaaattagggtttgcttatgttgatctcatttatggatcc |
5697379 |
T |
 |
| Q |
304 |
gataattgctctctccgtaggcaatttgggttgaactgcgaaaacaatttttgtctgttttttccttctact |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5697378 |
gataattgctctctccgtaggcaatttgggttgaactgcgaaaacaatctttgtctgttttttccttctact |
5697307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University