View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16832_high_26 (Length: 297)
Name: NF16832_high_26
Description: NF16832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16832_high_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 14 - 280
Target Start/End: Complemental strand, 22590852 - 22590586
Alignment:
| Q |
14 |
attatactaatgccttgtgttctacttggttatggtccatttgttcccccgtgtcctgactttttctggaggtgggttcctgctactagtaaccttgctt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22590852 |
attatactaatgccttgtgttctacttggttatggtccatttgttcccccgtgtcctgactttttctggaggtgggttcctgctactagtaaccttgctt |
22590753 |
T |
|
| Q |
114 |
cgtggttggttgctcatgggttatttagtttttctcgtggtagaagatagttccatgatggcttatgaatcccttagtgtaggtattatttgcttctcat |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
22590752 |
cgtggttggttactcatgggttatttagtttttctcgtggtagaagatagttccatgatggcttatgaatcccttagtgtaggtattctttgcttctcat |
22590653 |
T |
|
| Q |
214 |
gaggattgtattgcttgttggttaatatgttagggtggttctctaacagactttcttggtatcaagt |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
22590652 |
gaggattgtattgcttgttggttaatatgttagggtggttctctaattgactttcttggtatcaagt |
22590586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University