View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16832_high_27 (Length: 272)
Name: NF16832_high_27
Description: NF16832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16832_high_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 16 - 257
Target Start/End: Complemental strand, 23468381 - 23468142
Alignment:
| Q |
16 |
attcaccttatgaggtgagtatctagttaataggctacttaacaaacnnnnnnnncattaatgtagtgttattgtcaaatatttcttgattttataagca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23468381 |
attcaccttatgaggtgagtatctagttaataggctacttaacaaa--aaaaaaacattaatgtagtgttattatcaaatatttcttgattttataagca |
23468284 |
T |
 |
| Q |
116 |
aaaattcgttaaatacttgaattgcgttcattatggattttattttccatataaaatgaatcttcaccttttgatcctaagatatgtaacaatttctttg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| ||| |
|
|
| T |
23468283 |
aaaattcgttaaatacttgaattgcgttccttatggattttatttaccatataaaatgaatcttcaccttttgatcctaagatattcaacaatttcattg |
23468184 |
T |
 |
| Q |
216 |
gtcgggataacccgatgtttctacctttattatgagggtttc |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
23468183 |
gtcgggataacccgatgtttctacctttatttcgagggtttc |
23468142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University