View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16832_high_28 (Length: 266)
Name: NF16832_high_28
Description: NF16832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16832_high_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 10 - 141
Target Start/End: Original strand, 2154198 - 2154331
Alignment:
| Q |
10 |
tctatagtatcaataagtgcatcacacaaaaacaaatatcaccgcaaatgaaaatgactatattctttacatttatctgag--aaataaaattaaaacaa |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
2154198 |
tctatagtatcaataagtgcatcacacaaaaacaaatatcaccgcaaatgaaaatgactatattctttacatttatctgagaaaaaaaaaattaaaacaa |
2154297 |
T |
 |
| Q |
108 |
ttaaagtatgaaaatttgtttgaaaaagctagta |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
2154298 |
ttaaagtatgaaaatttgtttgaaaaagctagta |
2154331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 176 - 266
Target Start/End: Original strand, 2154327 - 2154414
Alignment:
| Q |
176 |
tagtatatcaaatagtttgtgttattttaacttgttatnnnnnnnnnnnttgttgaaaacatctgaaccaatgaatgtgattgctttctga |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2154327 |
tagtatatcaaatagtttgtgttattttaacttgttaaaaaaaaaaa---tgttgaaaacatctgaaccaatgaatgtgattgctttctga |
2154414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University