View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16832_high_35 (Length: 241)
Name: NF16832_high_35
Description: NF16832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16832_high_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 15 - 226
Target Start/End: Complemental strand, 2287875 - 2287664
Alignment:
| Q |
15 |
ttattctcctaacaaaatatatataaactgatcaaaaggctaagaacccataagtaatattttgatattagcctcacacccataaaacaggctcaataat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2287875 |
ttattctcctaacaaaatatatataaactgatcaaaaggctaagaacccataagtaatattttgatattagcctcacacccataaaacaggctcaataat |
2287776 |
T |
|
| Q |
115 |
aagttaataaccaccttagagaggtacttaaccccacccatttcttgaaaattgcacccctctggatttacaaattcggacggaaaaataccattttttc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2287775 |
aagttaataaccaccttagagaggtacttaaccccacccatttcttgaaaattgcacccctctggatttacaaattcggacggaaaaataccattttttc |
2287676 |
T |
|
| Q |
215 |
tggtgtctagat |
226 |
Q |
| |
|
|||||||||||| |
|
|
| T |
2287675 |
tggtgtctagat |
2287664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University