View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16832_high_42 (Length: 212)
Name: NF16832_high_42
Description: NF16832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16832_high_42 |
 | |
|
| [»] scaffold0014 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0014 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 40 - 193
Target Start/End: Complemental strand, 78670 - 78517
Alignment:
| Q |
40 |
gatgtagatgaatcaaatggattaagttgtcattaggtgactagagaaacagaacaccgaactttcccttcaccgttgccgtgccagctaaatcacattg |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
78670 |
gatgtagatgaatcaaatggattaagttgtcattaggtgactagagaaacagaacaccgaactttcccttcacttttgccgtgccagctaaatcacattg |
78571 |
T |
|
| Q |
140 |
aacttattaatgattgtccatctagtttatgattgtccgtgcttgaattagttc |
193 |
Q |
| |
|
|| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
78570 |
aaattattaatgattgtccatctaatttatgattgtccgtgcttgaattagttc |
78517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 44 - 193
Target Start/End: Original strand, 29483866 - 29484015
Alignment:
| Q |
44 |
tagatgaatcaaatggattaagttgtcattaggtgactagagaaacagaacaccgaactttcccttcaccgttgccgtgccagctaaatcacattgaact |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| |||||||||||||| ||||||||| | |
|
|
| T |
29483866 |
tagatgaatcaaatggattaagttgtcattaggtgactagagaaatagaacaccgaactttcccttcactgttaccgtgccagctaaaccacattgaaat |
29483965 |
T |
|
| Q |
144 |
tattaatgattgtccatctagtttatgattgtccgtgcttgaattagttc |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29483966 |
tattaatgattgtccatctagtttatgattgtccgtgcttgaattagttc |
29484015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University