View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16832_low_24 (Length: 320)
Name: NF16832_low_24
Description: NF16832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16832_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 2e-89; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 45 - 244
Target Start/End: Original strand, 17581962 - 17582161
Alignment:
| Q |
45 |
agttagataattttatgatgactgatgagaggtctgtccttgcctgataattttattaggcaaggagttttcatcatcaaactgttacgattgactgtcg |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17581962 |
agttagataattttatgatgactgatgagaggtctgtccttgcctgataattttattaggcaaggagttttcatcatcaaactgttacgattgaccgtcg |
17582061 |
T |
|
| Q |
145 |
gtatnnnnnnntgtttacagtgaaaggtatatctgaattaaatcaaaataaaaaatgatggttcaagagttttgctttctcatccaatatggtaactgca |
244 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17582062 |
ttataaaaaaatgtttacagtgaaaggtatatctgaattaaatcaaaataaaaaatgatagttcaagagttttgctttctcatccaatatggtaactgca |
17582161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 273 - 311
Target Start/End: Original strand, 17582163 - 17582201
Alignment:
| Q |
273 |
ccattttggaggttgcccctaagatagcacaggttctgc |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
17582163 |
ccattttggaggttgcccctaagatagcacaagttctgc |
17582201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 17581984 - 17581951
Alignment:
| Q |
1 |
agtcatcataaaattatctaacttggcatattta |
34 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
17581984 |
agtcatcataaaattatctaacttagcatattta |
17581951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 158 - 303
Target Start/End: Complemental strand, 14745292 - 14745143
Alignment:
| Q |
158 |
tttacagtgaaaggtatatctgaattaaatcaaaataaaaaatgatggttcaagagttttgctttctcatccaat----atggtaactgcagtctagtct |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |||||||||| |
|
|
| T |
14745292 |
tttacagtgaaaggtatatctgaattaaatcaaaataaaaaatgatggttcaagagttttgctttctcatgcaatatgcatggtaactgtagtctagtct |
14745193 |
T |
|
| Q |
254 |
acctcacttgaaaagcaagccattttggaggttgcccctaagatagcaca |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14745192 |
acctcacttgaaaagcaagccattttggaggttgcccctaagatagcaca |
14745143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 102 - 139
Target Start/End: Original strand, 53896354 - 53896391
Alignment:
| Q |
102 |
aggcaaggagttttcatcatcaaactgttacgattgac |
139 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||| |
|
|
| T |
53896354 |
aggcaaggagttttcaccaacaaactgttacgattgac |
53896391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 162 - 190
Target Start/End: Original strand, 53896417 - 53896445
Alignment:
| Q |
162 |
cagtgaaaggtatatctgaattaaatcaa |
190 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
53896417 |
cagtgaaaggtatatctgaattaaatcaa |
53896445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University