View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16832_low_31 (Length: 258)
Name: NF16832_low_31
Description: NF16832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16832_low_31 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 19 - 258
Target Start/End: Complemental strand, 37303185 - 37302948
Alignment:
| Q |
19 |
gcaagtaccttcaccacttgtgccaactagagagagttattttgtaaggtattgtaagcaacatgctgatggaacttgggcagtagtggatgtttctttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37303185 |
gcaagtaccttcaccacttgtgccaactagagagagttattttgtaaggtattgtaagcaacatgctgatggaacttgggcagtagtggatgtttctttg |
37303086 |
T |
 |
| Q |
119 |
gacaatttacgccctagtccttctgccagatcaagaagaaggccttctggttgcttaattcaagaaatgcccaatggctactcaaaggttatttttgtca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37303085 |
gacaatttacgccctagtccttctgccagatcaagaagaaggccttctggttgcttaattcaagaaatgcccaatggctactcaaaggttatttttgtca |
37302986 |
T |
 |
| Q |
219 |
caatattttttgagtacaaaattaagattgtgtttacatt |
258 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37302985 |
caata--ttttgagtacaaaattaagattgtgtttacatt |
37302948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 92; Significance: 9e-45; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 20 - 207
Target Start/End: Original strand, 16827118 - 16827305
Alignment:
| Q |
20 |
caagtaccttcaccacttgtgccaactagagagagttattttgtaaggtattgtaagcaacatgctgatggaacttgggcagtagtggatgtttctttgg |
119 |
Q |
| |
|
|||||||||||||| |||||||| ||| | |||||||| ||||||||||||||||| |||||| |||| || || |||||||| |||||||| ||||||| |
|
|
| T |
16827118 |
caagtaccttcaccccttgtgccgactcgtgagagttactttgtaaggtattgtaaacaacatcctgacgggacatgggcagttgtggatgtgtctttgg |
16827217 |
T |
 |
| Q |
120 |
acaatttacgccctagtccttctgccagatcaagaagaaggccttctggttgcttaattcaagaaatgcccaatggctactcaaaggt |
207 |
Q |
| |
|
| ||| | ||||| |||||||| | |||| |||||||||||||||||||||||||||||||| ||||| ||||| ||||||||||| |
|
|
| T |
16827218 |
ataatctgcgcccgagtccttcatctagatgtagaagaaggccttctggttgcttaattcaagagatgccaaatggttactcaaaggt |
16827305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University