View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16834_high_1 (Length: 302)
Name: NF16834_high_1
Description: NF16834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16834_high_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 6e-68; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 13 - 151
Target Start/End: Original strand, 12629289 - 12629427
Alignment:
| Q |
13 |
agagtaaaatcaatatttgtttcacctccattcaaaatatttgtttcacctgaaagttcaaaattagtttgggtagaattctagttttggaagttgtgta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12629289 |
agagtaaaatcaatatttgtttcacctccattcaaaatatttgtttcacctgaaagttcaaaattagtttgggtggaattctagttttggaagttgtgta |
12629388 |
T |
 |
| Q |
113 |
tggttctgtttgacagcagttcccatttctcatggggct |
151 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12629389 |
ttgttctgtttgacagcagttcccatttctcatggggct |
12629427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 148 - 187
Target Start/End: Original strand, 12629932 - 12629971
Alignment:
| Q |
148 |
ggctgagtccatcttgcttggagttggtgctgcaaggctt |
187 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12629932 |
ggctgagtccatcttgcttggagttggggctgcaaggctt |
12629971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University