View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16834_low_2 (Length: 274)
Name: NF16834_low_2
Description: NF16834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16834_low_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 256
Target Start/End: Original strand, 17110939 - 17111194
Alignment:
| Q |
1 |
gatgtgattatttcagaattagaaggcatgcataagctatttcatattgattgatgaatgctccatttgattttttcgcaatacaggttagaaggaaatc |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17110939 |
gatgtgattatttcagaattaaaaggcatgcataagctatttcatattgattgatgaatgctccatttgattttttcgcaatacaggttagaaggaaatc |
17111038 |
T |
 |
| Q |
101 |
cagtgagactttggtttgcttaaacattacaggaagaactttttgcttattcaagtgttggtttttggttctgattcaagtgttggtttcatattgtgtg |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17111039 |
cagtgagagtttggtttgcttaaacattacaggaagaactttttgcttattcaagtgttggtttttggttctgattcaagtgttggtttcatattgtgtg |
17111138 |
T |
 |
| Q |
201 |
tcatgtaccgagaaattatttgatgagaatatttgcaactcttagagatacataac |
256 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17111139 |
tcatgtactgagaaattatttgatgagaatatttgcaactcttagagatacataac |
17111194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University