View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16835_high_6 (Length: 327)
Name: NF16835_high_6
Description: NF16835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16835_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 9e-61; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 186 - 308
Target Start/End: Complemental strand, 4372131 - 4372009
Alignment:
| Q |
186 |
cactgatcagtttttgatgtcataccctttgacttaaccgattgaaccttaccaaaatctggatcattctgaccgtcacgtttcacttcttgagaccatt |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4372131 |
cactgatcagtttttgatgtcataccctttgacttaaccgattgaaccttaccaaaatctggatcattctgaccgtcacatttcacttcttgagaccatt |
4372032 |
T |
 |
| Q |
286 |
cctcttgtaaatgatccacaaga |
308 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
4372031 |
cctcttgtaaatgatccacaaga |
4372009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 8 - 64
Target Start/End: Complemental strand, 4372190 - 4372134
Alignment:
| Q |
8 |
attattctcattatcaatcacgagcctctcatacacccatgcatggtccttgaccca |
64 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4372190 |
attattctcattatcaaccacgagcctctcatacacccatgcatggtccttgaccca |
4372134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University