View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16838_high_8 (Length: 250)
Name: NF16838_high_8
Description: NF16838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16838_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 22602823 - 22603065
Alignment:
| Q |
1 |
tagatgataagtcactaatt-ctttctcttgtattcatgannnnnnnagatacattcaaactaaatgtgaagccaaacaagacatatctactaaggataa |
99 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
22602823 |
tagatgataagtcactaatttctttttcttgtattcatgatttttgtagatacattcaaactaaaggtgaagccaaacaagacatatctactaaggataa |
22602922 |
T |
 |
| Q |
100 |
tcaatgcagcactcaatgaagaactcttctttagcattgcaaatcacaccttaatagttgttgaagctgatgctagatacatcaaaccattcaccacaaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
22602923 |
tcaatgcagcactcaatgaagaactcttctttagcattgcaaatcacaccttaatagttgttgaagctgatgctagatacaccaaaccattcaacacaaa |
22603022 |
T |
 |
| Q |
200 |
cacactcctcataacaccaggacaaaccacaaatgttcatctc |
242 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22603023 |
cacacttctcataacaccaggacaaaccacaaatgttcttctc |
22603065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 81 - 173
Target Start/End: Complemental strand, 22636267 - 22636175
Alignment:
| Q |
81 |
acatatctactaaggataatcaatgcagcactcaatgaagaactcttctttagcattgcaaatcacaccttaatagttgttgaagctgatgct |
173 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||| || | |||||||||||||| ||||||||| | | |||||||| ||||||||| |
|
|
| T |
22636267 |
acatatctactaagaataatcaatgctgcactcaatgatgagatgttctttagcattgctaatcacaccctccttgttgttgatgctgatgct |
22636175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 47 - 172
Target Start/End: Complemental strand, 24069808 - 24069683
Alignment:
| Q |
47 |
agatacattcaaactaaatgtgaagccaaacaagacatatctactaaggataatcaatgcagcactcaatgaagaactcttctttagcattgcaaatcac |
146 |
Q |
| |
|
|||||||| |||| | || ||||||||| || |||||| ||||| | ||||||| || ||||||||||| |||||||| || |||||||| |||||| |
|
|
| T |
24069808 |
agatacatacaaattgaaggtgaagccaggaaaaacatatttactacgtttaatcaacgctgcactcaatgacgaactctttttcagcattgctaatcac |
24069709 |
T |
 |
| Q |
147 |
accttaatagttgttgaagctgatgc |
172 |
Q |
| |
|
|| ||||| |||||||||| ||||| |
|
|
| T |
24069708 |
acattaatcattgttgaagcagatgc |
24069683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 84 - 130
Target Start/End: Original strand, 4383658 - 4383704
Alignment:
| Q |
84 |
tatctactaaggataatcaatgcagcactcaatgaagaactcttctt |
130 |
Q |
| |
|
||||||||||| || |||||||| ||||||||||||||||| ||||| |
|
|
| T |
4383658 |
tatctactaagaatcatcaatgctgcactcaatgaagaacttttctt |
4383704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University