View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16839_high_16 (Length: 247)
Name: NF16839_high_16
Description: NF16839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16839_high_16 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 18 - 247
Target Start/End: Original strand, 28993411 - 28993640
Alignment:
| Q |
18 |
aatccgaacacttcctcggaccatttaaatagttctctaaacacgttcgtgctaagatactttagaggaaccacaaatcgcttgcgatcaatgctgtaaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28993411 |
aatccgaacacttcctcggaccatttaaagagttctctaaacacgttcgtgctaagatactttagaggaaccacaaatcgcttgcgatcaatgctgtaaa |
28993510 |
T |
|
| Q |
118 |
caacaaagtgacccttatttactgatgaagagttcatatccacttcgtttcttgggtatgagatcctcttgcgcttttcaaccgccattttctgccactt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28993511 |
caacaaagtgacccttatttactgatgaagagttcatatccacttcgtttcttgggtatgagatcctcttgcgcttttcaaccgccattttctgccactt |
28993610 |
T |
|
| Q |
218 |
tttcgccatttctattagcctttttgcact |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
28993611 |
tttcgccatttctattagcctttttgcact |
28993640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University