View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16839_high_17 (Length: 240)
Name: NF16839_high_17
Description: NF16839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16839_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 18 - 220
Target Start/End: Original strand, 54339773 - 54339975
Alignment:
| Q |
18 |
atataacacaaatgtaaccaacatattctctaacgtactatcaaacagcaaagacattagagtcannnnnnnnccctcgcatgtacatttgttgcataat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
54339773 |
atataacacaaatgtaaccaacatattctctaacgtactatcaaacagcaaagacattagagtcatttttttttcctcgcatgtacatttgttgcataat |
54339872 |
T |
 |
| Q |
118 |
gttattggatttttggtcccctagctagagttcatgtgttagcttctaactatgatgtgaatagtaaactgtaatggggtatactgctaccatatcccta |
217 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
54339873 |
gttattggatttttggtcccctggctagagttcatgtgttagcttctaactatggtgtgaatagtaaactgtaatggggtatactgctaccatgtcccta |
54339972 |
T |
 |
| Q |
218 |
gta |
220 |
Q |
| |
|
||| |
|
|
| T |
54339973 |
gta |
54339975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University