View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16839_low_15 (Length: 288)
Name: NF16839_low_15
Description: NF16839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16839_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 12 - 272
Target Start/End: Original strand, 41223051 - 41223305
Alignment:
| Q |
12 |
gaatatagttccgaagacatagaatcgaaaaattctattgaattgaattgaactcctttttaatgtgaatcaatatcctgcctctgcgcacgactgcaga |
111 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| ||||| |||| |||||||||||||||| |
|
|
| T |
41223051 |
gaatatagttccgaagacatagaatcaaaaaattctattgaattgaa-----ctcctttttaatgtgaatcagtatccagcctttgcgcacgactgcaga |
41223145 |
T |
 |
| Q |
112 |
gactaattactcgaaccggataggatcacaaagggatcaaatctctccctctgagtattttgtttgtgaagctacactttggactgaatgatggtaatcc |
211 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41223146 |
gactaattcctcgaaccggataggatcacaaagg-atcaaatctctccctctgagtattttctttgtgaagctacactttggactgaatgatggtaatcc |
41223244 |
T |
 |
| Q |
212 |
ttgttgaacaaggagacaaaagtggtacttttgtgtgtctgtgttttttatggtgacgttg |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41223245 |
ttgttgaacaaggagacaaaagtggtacttttgtgtgtctgtgttttttatggtgacgttg |
41223305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University