View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1683_low_2 (Length: 305)
Name: NF1683_low_2
Description: NF1683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1683_low_2 |
| |
|
Alignment Details
Target: chr6 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 304
Target Start/End: Complemental strand, 8168244 - 8167958
Alignment:
Q |
18 |
atagtatcataccatgattttgatttcttctcactctttgtctgcatacaaacatagaaagaatatgagtcactaaatggtcaaaatcatattagataa- |
116 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| | || ||| | || | ||||||||||||||||||| |
|
|
T |
8168244 |
atagtatcataccatgattttgatttcttctcactctttgtctgtatgcaaacatagaaagcaacagaatcagtcaa-gatcaaaatcatattagataaa |
8168146 |
T |
|
Q |
117 |
tgatagaacagctatattggattgattaaacatacctcaaacttttcgatatcctctttgatgatggacataccatagtcacttagttttggaatgtagt |
216 |
Q |
|
|
|| || |||||| | | ||||||||||||||||||||| |||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| ||| |
|
|
T |
8168145 |
tggtataacagcaacaatggattgattaaacatacctcgaacttttcgatatcctctctgatgatggaaataccatagtcacttagttttggaatgcagt |
8168046 |
T |
|
Q |
217 |
gttcatcaagtaacacactctttgtctttaattggttgctaaaacatcctggtataacaccagtatgtaagaaatgcactgcctttgc |
304 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8168045 |
gttcatcaagtaacacactctttgtctttagttggttgctaaaacatcctggtataacaccagtatgtaagaaatgcactgcctttgc |
8167958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 183 - 301
Target Start/End: Original strand, 10976532 - 10976650
Alignment:
Q |
183 |
gacataccatagtcacttagttttggaatgtagtgttcatcaagtaacacactctttgtctttaattggttgctaaaacatcctggtataacaccagtat |
282 |
Q |
|
|
||||||||||||||||||||||| |||| | ||||| |||||||| ||| | ||||||||||||| ||| |||||||| |||||||||| ||||||| |
|
|
T |
10976532 |
gacataccatagtcacttagtttgggaaagcgatgttcgtcaagtaaaacattgtttgtctttaatttgtttctaaaacaacctggtataattccagtat |
10976631 |
T |
|
Q |
283 |
gtaagaaatgcactgcctt |
301 |
Q |
|
|
|||| |||||||| ||||| |
|
|
T |
10976632 |
gtaaaaaatgcaccgcctt |
10976650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 13184 times since January 2019
Visitors: 1253