View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1683_low_2 (Length: 305)

Name: NF1683_low_2
Description: NF1683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1683_low_2
NF1683_low_2
[»] chr6 (1 HSPs)
chr6 (18-304)||(8167958-8168244)
[»] chr7 (1 HSPs)
chr7 (183-301)||(10976532-10976650)


Alignment Details
Target: chr6 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 304
Target Start/End: Complemental strand, 8168244 - 8167958
Alignment:
18 atagtatcataccatgattttgatttcttctcactctttgtctgcatacaaacatagaaagaatatgagtcactaaatggtcaaaatcatattagataa- 116  Q
    |||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |   || ||| | || | |||||||||||||||||||     
8168244 atagtatcataccatgattttgatttcttctcactctttgtctgtatgcaaacatagaaagcaacagaatcagtcaa-gatcaaaatcatattagataaa 8168146  T
117 tgatagaacagctatattggattgattaaacatacctcaaacttttcgatatcctctttgatgatggacataccatagtcacttagttttggaatgtagt 216  Q
    || || |||||| | | ||||||||||||||||||||| |||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| |||    
8168145 tggtataacagcaacaatggattgattaaacatacctcgaacttttcgatatcctctctgatgatggaaataccatagtcacttagttttggaatgcagt 8168046  T
217 gttcatcaagtaacacactctttgtctttaattggttgctaaaacatcctggtataacaccagtatgtaagaaatgcactgcctttgc 304  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8168045 gttcatcaagtaacacactctttgtctttagttggttgctaaaacatcctggtataacaccagtatgtaagaaatgcactgcctttgc 8167958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 183 - 301
Target Start/End: Original strand, 10976532 - 10976650
Alignment:
183 gacataccatagtcacttagttttggaatgtagtgttcatcaagtaacacactctttgtctttaattggttgctaaaacatcctggtataacaccagtat 282  Q
    ||||||||||||||||||||||| |||| |   ||||| |||||||| ||| | ||||||||||||| ||| |||||||| ||||||||||  |||||||    
10976532 gacataccatagtcacttagtttgggaaagcgatgttcgtcaagtaaaacattgtttgtctttaatttgtttctaaaacaacctggtataattccagtat 10976631  T
283 gtaagaaatgcactgcctt 301  Q
    |||| |||||||| |||||    
10976632 gtaaaaaatgcaccgcctt 10976650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 13184 times since January 2019
Visitors: 1253