View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1684-Insertion-1 (Length: 182)
Name: NF1684-Insertion-1
Description: NF1684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1684-Insertion-1 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 3e-56; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 7 - 182
Target Start/End: Original strand, 39128376 - 39128550
Alignment:
| Q |
7 |
atatattttgttaatggtagtagtaaatgtttgttttatttttgttagtgagagggtttcaaaaccattttatgctttgtgtcaatacaatagtatcact |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39128376 |
atatattttgttaatggtagtagtaaatgtttgttttatttttgttagtgagagggtttcaaaaccattttatgctctgtgtcaatacaatagtatcact |
39128475 |
T |
|
| Q |
107 |
gtgtttatgtttgannnnnnnnnnnnnnnnacccttgttttgtaattactacatgtctatttccatggtgtatatc |
182 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39128476 |
ttgtttatgtttga-ttttttgttttttttacccttgttttgtaattactacatgtctatttccatggtgtttatc |
39128550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000004
Query Start/End: Original strand, 75 - 120
Target Start/End: Original strand, 39128564 - 39128609
Alignment:
| Q |
75 |
tttatgctttgtgtcaatacaatagtatcactgtgtttatgtttga |
120 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39128564 |
tttatgctttgtgtcaacacaatagtatcactgtgtttatgtttga |
39128609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University