View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1684-Insertion-5 (Length: 237)
Name: NF1684-Insertion-5
Description: NF1684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1684-Insertion-5 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 7 - 237
Target Start/End: Original strand, 50177190 - 50177437
Alignment:
| Q |
7 |
aattactactttgtatcaatgatcaactttctttttgcttacacacaatttggtatcaataaagtgattatgatgatgcataaagaactggagg------ |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
50177190 |
aattactactttgtatcaatgatcaactttctttttgcttacacacaatttggtatcaataaagtgattatgatgatgcataaagaactggaagaacttg |
50177289 |
T |
|
| Q |
101 |
-----------gaatcctccattgtatgcaataagtaagcaaaactaatatttattgttctttagcataaagtaaaaagagggtctaaattttgattaat |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50177290 |
aaatagtaggtgaatcctccattgtatgcaataagtaagcaaaactaatatttatttttctttagcataaagtaaaaagagggtctaaattttgattaat |
50177389 |
T |
|
| Q |
190 |
tttttataatcatctaaataagatgggttatccattgatgttttgcag |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50177390 |
tttttataatcatctaaataagatgggttatccattgatgttttgcag |
50177437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University