View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16840_high_29 (Length: 287)
Name: NF16840_high_29
Description: NF16840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16840_high_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 6 - 261
Target Start/End: Original strand, 33740211 - 33740477
Alignment:
| Q |
6 |
agtaacaaaacttagtgttggttgaatcacaacgtggacatggaagattctcttgctccggtgccggtgcaccggggcggatttgaggttttgttgatcg |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33740211 |
agtaacaaaacttagtgttggttgaatcacaacgtggacatggaagattctcttgctccggtgccggtgcaccggggcggatttgaggttttgttgatcg |
33740310 |
T |
|
| Q |
106 |
gcggctttcaccggagtccgaagatgtcattgtttagtatttggaaaaagttggtgaaaaaacaaacaagtgtagaatgtaagtaatgtagggttttcgt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| || |
|
|
| T |
33740311 |
gcggctttcaccggagtccgaagatgtcattgtttagtatttggaagaagttggtgaaaaaacaaacaagtgtagaatgcaagtaatgtagggtttttgt |
33740410 |
T |
|
| Q |
206 |
ttattt-------atgagatgttatgaaataaccgaat----aagaaggataagaaggagtgtaatg |
261 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33740411 |
ttatttatgagagatgagatgttatgaaataaccgaataagaaagaaggataagaaggagtgtaatg |
33740477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University