View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16840_high_39 (Length: 246)
Name: NF16840_high_39
Description: NF16840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16840_high_39 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 23 - 246
Target Start/End: Original strand, 30769655 - 30769878
Alignment:
| Q |
23 |
gatcacgcgttaatgaaacaatgaacgacgattccttccctaatgtccccggaggcaagcttcggctcatgtgcagctacggaggccacataatgccgcg |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30769655 |
gatcacgcgttaatgaaacaatgaacgacgattccttccctaatgtccccggaggcaagcttcggctaatgtgcagctacggaggccacataatgccgcg |
30769754 |
T |
 |
| Q |
123 |
ccctcacgataagtctttatgttatgtaggcggtgacaccagaatcgtggtcgtggatcgcagttcttctctgagagacctatgttcacgcctttcgaga |
222 |
Q |
| |
|
|||||| ||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
30769755 |
ccctcatgataagtctctatgttatgtaggtggtgacaccagaatcgtggtcgtggatcgcagttcttctctgagagacctatgttcgcgtctttcgaga |
30769854 |
T |
 |
| Q |
223 |
acaattctcaatggaagacccttt |
246 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
30769855 |
acaattctcaatggaagacccttt |
30769878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University