View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16840_high_47 (Length: 222)
Name: NF16840_high_47
Description: NF16840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16840_high_47 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 18 - 198
Target Start/End: Original strand, 28479541 - 28479720
Alignment:
| Q |
18 |
aggaggcggtcacatgtgtagggatgacaatgagtagggtctggatagggtactatattacttttt-ctacatctgtgatttnnnnnnntcccctatctc |
116 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
28479541 |
aggaggcggccacatgtgtagggatgacaatgagtagggtctggatagggtactatattacttttttctacatctgtgatttgaaaaaatcccctatctg |
28479640 |
T |
|
| Q |
117 |
gaccctattacagggatatggcatgtaaagtgctagttgaatctctcaaactatatgtagacagaaatgtatcatgtagtat |
198 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28479641 |
gacc--attacagggatatggcatgtaaagtgctagttgaatctctcaaactatatgtagacagaaatgtatcatgtagtat |
28479720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University