View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16840_high_48 (Length: 221)
Name: NF16840_high_48
Description: NF16840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16840_high_48 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 79 - 205
Target Start/End: Original strand, 19271956 - 19272082
Alignment:
| Q |
79 |
ggtaaagtatctccagaactcaggacctgttatttaaggggcacaccttggtaaattagttgcttgcaatttccagttaccttcacttactctattggtt |
178 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19271956 |
ggtaaagtatcttcagaactcaggacctgttatttaaggggcacaccttggtaaattagttgcttgcaatttccagttaccttcacttactctattggtt |
19272055 |
T |
|
| Q |
179 |
ctcgattatggtgcatttcatcatatt |
205 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
19272056 |
ctcgattatggtgcatttcatcatatt |
19272082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University