View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16840_high_53 (Length: 202)
Name: NF16840_high_53
Description: NF16840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16840_high_53 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 1 - 192
Target Start/End: Original strand, 9279986 - 9280175
Alignment:
| Q |
1 |
ttgatgtatcattaatgtgattttgttgtactttgaagattattcttcaacctgtcagtatatgtaaacttgaatgcataatgaaaaataaattgatata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9279986 |
ttgatgtatcattaatgtgattttgttgtaatttgaagattattcttcaacctgtcagtatatgtaaactcgaatgcataatgaaaaataaattgatata |
9280085 |
T |
|
| Q |
101 |
caatcacttgaagttggattttattctctctgtctaataattgctgacttgcaatcatcttcacttatcttttaatttgtatacctcctttg |
192 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9280086 |
caatcacttgaagttggatttta--ctctctgtctaataattgctgacttgcaatcatcttcacttatcttttaatttgtatacctcttttg |
9280175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University