View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16840_low_35 (Length: 263)
Name: NF16840_low_35
Description: NF16840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16840_low_35 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 5 - 252
Target Start/End: Complemental strand, 39310339 - 39310089
Alignment:
| Q |
5 |
tcagttgacgtcgttcttctgttcacgacttcaactgtctttgaacaattttcaagtaccggcctagggcgt---agtagaactcgacacaaactagctg |
101 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||| ||||| |||||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
39310339 |
tcagttgacgttgttcttctgttcacagcttcaactggctttggacaattttcaagtaccggcctagggcgtcataatagaactcgacacaaactagctg |
39310240 |
T |
|
| Q |
102 |
tggagcaataggtcttgtttgtatcagtagaaaacatatatacatatcatatgtctcaaagttcaactcatatcaatcgtaaagatgatgattgctatct |
201 |
Q |
| |
|
||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39310239 |
tggggcaataggtcttgtttgtatcagtagaaaatatatatacatatcatatgtctcaaagttcaactcatatcaatcgtaaagatgatgattgctatct |
39310140 |
T |
|
| Q |
202 |
acttttggaaaattgcttcttcaattgtctttggtggcttatgattgatga |
252 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39310139 |
acttctggaaaattgcttcttcaattgtctttggtggcttatgatttatga |
39310089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 146
Target Start/End: Complemental strand, 38848547 - 38848503
Alignment:
| Q |
102 |
tggagcaataggtcttgtttgtatcagtagaaaacatatatacat |
146 |
Q |
| |
|
|||||| ||||||||||||| ||||||| |||||| ||||||||| |
|
|
| T |
38848547 |
tggagcgataggtcttgtttatatcagttgaaaacttatatacat |
38848503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University