View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16840_low_39 (Length: 252)
Name: NF16840_low_39
Description: NF16840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16840_low_39 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 43244839 - 43245079
Alignment:
| Q |
1 |
atggaggccaggttgtgggttttaagggacgaggtgattggtatttggactcaattgccttcactttgtcaagtgcacccacaaaatctctgcttcagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43244839 |
atggaggccaggttgtgggttttaagggacgaggtgattggtatttggactcaattgccttcactttgtcaagtgcacccacaaaatctctgcttcagaa |
43244938 |
T |
|
| Q |
101 |
ggtgcagagaggcttgtataggctcacaagcattgctccaaaatcttcatccacttgggctgcttagaagactatatatgggaatttaagcctcttgcct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43244939 |
ggtgcagagaggcttgtataggctcacaagcattgctccaaaatcttcttccactagggctgcttagaagactatatatgggaatttaagcctcttgcct |
43245038 |
T |
|
| Q |
201 |
cagtattgagtaatttggttcatgctatattgtttgccttt |
241 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43245039 |
cagtcttgagtaatttggttcatgctatattgtttgccttt |
43245079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 62 - 173
Target Start/End: Original strand, 39866039 - 39866140
Alignment:
| Q |
62 |
cactttgtcaagtgcacccacaaaatctctgcttcagaaggtgcagagaggcttgtataggctcacaagcattgctccaaaatcttcatccacttgggct |
161 |
Q |
| |
|
|||||| || |||||||||||||| ||||||||||| |||||||||||||||| || |||||||||||||||||||||||||| |||| |
|
|
| T |
39866039 |
cactttatctagtgcacccacaaagtctctgcttcataaggtgcagagaggctcgt----------aagcattgctccaaaatcttcatccaacaaggct |
39866128 |
T |
|
| Q |
162 |
gcttagaagact |
173 |
Q |
| |
|
|||||||||||| |
|
|
| T |
39866129 |
gcttagaagact |
39866140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University