View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16840_low_43 (Length: 241)
Name: NF16840_low_43
Description: NF16840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16840_low_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 16 - 234
Target Start/End: Original strand, 48893144 - 48893366
Alignment:
| Q |
16 |
cactttgttgtcaaccaaactgttcctacacgcacagtttcatcacgtttgtgcgcacagaaaacagtaacttgtttcaccttgtctactttgagtaaga |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48893144 |
cactttgttgtcaaccaaactgttcctacacgcacagtttcatcatgtttgtgcgcacagaaaacagtaacttgtttcaccttgtctactttgagtaaga |
48893243 |
T |
 |
| Q |
116 |
atgtcccatatcctatccaatagtataataaaacaaaacccattcatcaatgtcccttaa---tcctccagtactcactttggttggcaataaacatgta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
48893244 |
atgtcccatatcctatccaatagtataataaaacaaaacccattcatcaatgtcccttaatcctcctccggtactcactttggttagcaataaacatgta |
48893343 |
T |
 |
| Q |
213 |
cttaattaa-ttagtagtattat |
234 |
Q |
| |
|
||||||||| ||||||||||||| |
|
|
| T |
48893344 |
cttaattaatttagtagtattat |
48893366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University