View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16840_low_45 (Length: 238)
Name: NF16840_low_45
Description: NF16840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16840_low_45 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 2 - 222
Target Start/End: Complemental strand, 27477575 - 27477353
Alignment:
| Q |
2 |
gtcactgttatattttatggcatcacagtgggcattcttttggccatccctcacccagcatttcaaattttggggttaaaaatattaaatatgtatacct |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27477575 |
gtcactgttatattttatggcatcacagtgggcattcttttggccatccctcagccagcatttcaaattttggggttaaaaatattaaatatgtatacct |
27477476 |
T |
|
| Q |
102 |
gttcacacaaaacctgcagttgtagttgcagctgnnnnnnnctaggggctgttgtatgacttgcagaatatatttgtttcatggataaaaaacaaatttg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27477475 |
gttcacacaaaacctgcagttgtagttgcagctgaaaaaaactaggggctgttgtatgacttgcagaatatatttgtttcatggataaaaaacaaatttg |
27477376 |
T |
|
| Q |
202 |
aagtaatt--caacttgctacct |
222 |
Q |
| |
|
|||||||| ||||||||||||| |
|
|
| T |
27477375 |
aagtaattcacaacttgctacct |
27477353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University