View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16840_low_51 (Length: 221)

Name: NF16840_low_51
Description: NF16840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16840_low_51
NF16840_low_51
[»] chr2 (1 HSPs)
chr2 (79-205)||(19271956-19272082)


Alignment Details
Target: chr2 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 79 - 205
Target Start/End: Original strand, 19271956 - 19272082
Alignment:
79 ggtaaagtatctccagaactcaggacctgttatttaaggggcacaccttggtaaattagttgcttgcaatttccagttaccttcacttactctattggtt 178  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19271956 ggtaaagtatcttcagaactcaggacctgttatttaaggggcacaccttggtaaattagttgcttgcaatttccagttaccttcacttactctattggtt 19272055  T
179 ctcgattatggtgcatttcatcatatt 205  Q
    |||||||||||||||||||||||||||    
19272056 ctcgattatggtgcatttcatcatatt 19272082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University