View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16841_high_14 (Length: 266)
Name: NF16841_high_14
Description: NF16841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16841_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 13 - 194
Target Start/End: Original strand, 36139773 - 36139954
Alignment:
| Q |
13 |
tgaagaacttaatgcagtcactcgggagcgggatgatataaagaagcaatatgatgaattgagaaagaagaggtgtgcaggttatttattttgtattgtt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36139773 |
tgaagaacttaatgcagtcactcgggagcgggatgatataaagaagcaatatgatgaattgagaaagaagaggtgtgcaggttatttattttgtattgtt |
36139872 |
T |
 |
| Q |
113 |
gacttgctttattattttctatttgtgaaaaatgtaagctgaatctttcatttcagattggatgagtttatggaaggattta |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36139873 |
gacttgctttattattttctatttgtgaaaaatgtaagctgaatctttcatttcagattggatgagtttatggaaggattta |
36139954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 13 - 245
Target Start/End: Original strand, 30820469 - 30820700
Alignment:
| Q |
13 |
tgaagaacttaatgcagtcactcgggagcgggatgatataaagaagcaatatgatgaattgagaaagaagaggtgtgcaggttatttattttgtattgtt |
112 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||||||||||||| |||||||||||||||||| |||||||||| | |||| |||||||| || |
|
|
| T |
30820469 |
tgaagaacttaatgcagtcactcaggagcgagatgatataaagaagcaacatgatgaattgagaaagaggaggtgtgcatgcaatttcttttgtatcatt |
30820568 |
T |
 |
| Q |
113 |
gacttgctttattattttctatttgtgaaaaatgtaagctgaatctttcatttcagattggatgagtttatggaaggatttaatgccatatcattaaagt |
212 |
Q |
| |
|
|||| ||||| |||| ||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30820569 |
gactat-tttatgatttcctatttgtgaaaaatttaagctgaatctttaatttcagattggatgagtttatggaaggatttaatgccatatcattaaagt |
30820667 |
T |
 |
| Q |
213 |
taaaggaaatgtaccaggtttggaaatcccctc |
245 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
30820668 |
taaaggaaatgtaccaggtatggaaatcccctc |
30820700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University