View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16841_high_16 (Length: 239)
Name: NF16841_high_16
Description: NF16841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16841_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 17 - 228
Target Start/End: Original strand, 40790745 - 40790955
Alignment:
| Q |
17 |
atcatgatcgatagatggggtcatcgatcaaaatactaaagattctttctcacttcagtgctaaaaattccattcatgnnnnnnnnncttcatatatatg |
116 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40790745 |
atcatgatagatagatggggtcatcaatcaaaatactaaagattctttcttacttcagtgctaaaaattccattcatgtttttttt-cttcatatatatg |
40790843 |
T |
 |
| Q |
117 |
tagatgtggccatacgtgggagaagggtccatataatatgcaaaggcatattgtaaaagatccttaattatcttacnnnnnnnnaatgatttgttcccca |
216 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40790844 |
tagttgtggccatacgtgggagaagggtccatataatatgcaaaggcatattgtaaaagatccttaattatcttacttttttttaatgatttgttcccca |
40790943 |
T |
 |
| Q |
217 |
ccaatattcttc |
228 |
Q |
| |
|
|||||||||||| |
|
|
| T |
40790944 |
ccaatattcttc |
40790955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University