View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16841_low_11 (Length: 282)
Name: NF16841_low_11
Description: NF16841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16841_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 86; Significance: 4e-41; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 1 - 165
Target Start/End: Complemental strand, 24522247 - 24522083
Alignment:
| Q |
1 |
acattgggtgtagaaattggtgatggaaaattgggaattggaaaagaattggaaaccctnnnnnnnnnnnnnnnnnnnnnnnnnaaccctaggaggaacg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24522247 |
acattgggtgtagaaattggtgatggaaaattgggaattggaaaagaattggaaaccctagagagagaaagaaggagagagagaaaccctaggaggaacg |
24522148 |
T |
 |
| Q |
101 |
tcggaggagggatctggtgcggaggagcgtcggacgcgtttcttctctgccgcgcctcccgatga |
165 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24522147 |
tcggtggagggatctggtgcggaggagcgtcggacgcgtttcttctctgccgcgcctcccgatga |
24522083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 226 - 277
Target Start/End: Complemental strand, 24522024 - 24521973
Alignment:
| Q |
226 |
agtacaagaagattcaatacattacaaatattaatttaatatattcttggac |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24522024 |
agtacaagaagattcaatacattacaaatattaatttaatatattattggac |
24521973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University