View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16841_low_18 (Length: 238)
Name: NF16841_low_18
Description: NF16841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16841_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 190
Target Start/End: Original strand, 21663758 - 21663946
Alignment:
| Q |
1 |
gtcatttgtgcgtggtctctaatttcatcacttctgtgaggagcattgctctatttcattttaattttcttctatagtttcattttggggactttaaata |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
21663758 |
gtcatttgtgtgtggtctctaatttcatcacttctgtgaggagcattgctctatttcattttaattttcttctatagtttcattttggggactttaaa-a |
21663856 |
T |
 |
| Q |
101 |
taatcaaaaataagttattttagccttacttttgaaagaattatgataaaccaactaggtcaaatcaggatcatgacaaaacacactagg |
190 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21663857 |
taatcaaaaataagttattttagccttatttttgaaagaattatgataaaccaactaggtcaaatcaggatcatgacaaaacacactagg |
21663946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University