View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16842_high_4 (Length: 236)
Name: NF16842_high_4
Description: NF16842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16842_high_4 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 16 - 236
Target Start/End: Original strand, 2003722 - 2003943
Alignment:
| Q |
16 |
tttatctttgttgtgactcttgattcttttgtccccattctagaactactcaccagtataacactaattatttactgggctataagagtattatgttaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2003722 |
tttatctttgttgtgactcttgattcttttgtccccattctagaactactcaccagtataacactaattatttactgggctataagagtattatgttaaa |
2003821 |
T |
 |
| Q |
116 |
cattttgttaa-taatagaacttctgttagaaggggatgattttttgatttgtgtacaccttttcatgccatgttcttggattggctggaattccttatg |
214 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2003822 |
cattttgttaagtaatagaacttctgttagaaggggatcatttattgatttgtgtacaccttttcatgctatgttcttggattggctggaattccttatg |
2003921 |
T |
 |
| Q |
215 |
atatgctaatgtacttttttac |
236 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2003922 |
atatgctaatgtacttttttac |
2003943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University