View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16842_low_2 (Length: 260)
Name: NF16842_low_2
Description: NF16842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16842_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 8e-76; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 98 - 245
Target Start/End: Original strand, 42479380 - 42479527
Alignment:
| Q |
98 |
aaggtgtgtcttaaagctagaatatgtcttaaagttaaagcacatttgttaaaaatactcatagattatttatcaatctgagtggagtatgaatcacaat |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42479380 |
aaggtgtgtcttaaagctagaatatgtcttaaagttaaagcacatttgttaaaaatactgatagattatttatcaatctgagtggagtatgaatcacaat |
42479479 |
T |
 |
| Q |
198 |
cttaacaacctaaccaatcatatttggtcacttatttatgtgttaaat |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42479480 |
cttaacaacctaaccaatcatatttggtcacttatttatgtgttaaat |
42479527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 42479276 - 42479308
Alignment:
| Q |
1 |
gctaactagaataatgaatacaaattctaattc |
33 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
42479276 |
gctaactagaataatgaatacaaattccaattc |
42479308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University