View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16844_low_2 (Length: 433)
Name: NF16844_low_2
Description: NF16844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16844_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 399; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 399; E-Value: 0
Query Start/End: Original strand, 10 - 420
Target Start/End: Complemental strand, 43535648 - 43535238
Alignment:
| Q |
10 |
catcatcattctctatcttcccttcacttcaaaccccaaactccaaccatgctcatctcttcaatccaatcaaattccctaaattccattttaattcaag |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43535648 |
catcatcattctctatcttcccttcacttcaaaccccaaactccaaccatgctcatctcttcaatccaatcaaattccctaaattccattttaattcaag |
43535549 |
T |
|
| Q |
110 |
aagactctcttcaccaccacgctctcatcctacctttccccatctctacaaaacctcttcaactcttcgccgtagaattccatgtagtaaagctttgaaa |
209 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43535548 |
aagactctcttctccaccacgctctcatcctacctttccccatctctacaaaacctcttcaactcttcgccgtagaattccatgtagtaaagctttgaaa |
43535449 |
T |
|
| Q |
210 |
gactccggcggaggtgacggcgacggtggtggtggtgaccgggatgtggataagaaaaatgagtcgtcgggaccttttcctgattggttgaattttactt |
309 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43535448 |
gactccggcggaggtggcggcgacggtggtggtggtgaccgggaggtggataagaaaaatgagtcgtcgggaccttttcctgattggttgaattttactt |
43535349 |
T |
|
| Q |
310 |
ctgatgatgcgaaaactgtgtttgctgctcttgctatatcacttgcgtttcgtactttcattgctgagcctaggttcattccttccttgtcaatgtatcc |
409 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43535348 |
ctgatgatgcgaaaactgtgtttgctgctcttgctatatcacttgcgtttcgtactttcattgctgagcctaggttcattccttccttgtcaatgtatcc |
43535249 |
T |
|
| Q |
410 |
tacttatgatg |
420 |
Q |
| |
|
||||||||||| |
|
|
| T |
43535248 |
tacttatgatg |
43535238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University