View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16845_high_7 (Length: 271)
Name: NF16845_high_7
Description: NF16845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16845_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 18 - 247
Target Start/End: Complemental strand, 24169588 - 24169359
Alignment:
| Q |
18 |
ttgagaatatgagaaactttctttatgctgttaaggatatgcaactcttgacttttgaagcttctgatttagagaaggtgactcaatcatttcccctatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24169588 |
ttgagaatatgagaaactttctttatgctgttaaggatatgcaactcttgacttttgaagcttctgatttagagaaggtgactcaatcatttcccctatt |
24169489 |
T |
 |
| Q |
118 |
tcttctttaattaannnnnnnnnnnnnnnnnnngattagtgttttgaaacatgaaaatgcagggaggatcatcaaataaagttgtggactgcattctatg |
217 |
Q |
| |
|
|||||||||||||| |||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24169488 |
tcttctttaattaatttgtttgtttgttttttggattggtgttttgaaacttgaaaatgcagggaggatcatcaaataaagttgtggactgcattctatg |
24169389 |
T |
 |
| Q |
218 |
tttaaaaggatactatgaatggaaactatc |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
24169388 |
tttaaaaggatactatgaatggaaactatc |
24169359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 194 - 247
Target Start/End: Complemental strand, 42237320 - 42237267
Alignment:
| Q |
194 |
taaagttgtggactgcattctatgtttaaaaggatactatgaatggaaactatc |
247 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||| || ||||||||||| ||||| |
|
|
| T |
42237320 |
taaagttgtggactgcattctctgtttgaaagggtattatgaatggaagctatc |
42237267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University