View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16845_low_16 (Length: 251)
Name: NF16845_low_16
Description: NF16845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16845_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 42678481 - 42678719
Alignment:
| Q |
1 |
cgttgatgctctaaacatcattcagatcggtcttaccttatcggatgcaattggtaacctccctagtgatgagaacaatcgttacatctgggaattcaat |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42678481 |
cgttgatgctctaaacattattcagatcggtcttaccttatcggatgcaattggtaacctccctagtgatcagaacaatcgttacatctgggaattcaat |
42678580 |
T |
|
| Q |
101 |
ttccgtgattttaacgtcaagagggacctccacaataaagactccattgacatgctccgccgtcagggtatcgacttctttcgtaacactgttcaaggtg |
200 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||| |||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42678581 |
ttccgtgactttaacgtcaagagggatctccacaacaaagactccattgacatgctccaccgtcagggtatcaacttctttcgtaacactgttcaaggtg |
42678680 |
T |
|
| Q |
201 |
tggactcgtttcattttgcgatgctgatgcggtggtctg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42678681 |
tggactcgtttcattttgcgatgctgatgcggtggtctg |
42678719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 138 - 178
Target Start/End: Complemental strand, 54704130 - 54704090
Alignment:
| Q |
138 |
aagactccattgacatgctccgccgtcagggtatcgacttc |
178 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
54704130 |
aagattccattgacatgctccgccgtcaaggtattgacttc |
54704090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University