View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16845_low_21 (Length: 232)
Name: NF16845_low_21
Description: NF16845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16845_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 20 - 217
Target Start/End: Complemental strand, 45264758 - 45264561
Alignment:
| Q |
20 |
taatatatatcattttgtgacaccattgtattgtatcttactgagcgaacgatagttaactaccgttgaagataaaatgatcaatttcggatgtctgaaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45264758 |
taatatatatcattttgtgacaccattgtattgtatcttactaagcgaacgatagttaactaccgttgaagataaaatgatcaatttcgggtgtctgaaa |
45264659 |
T |
|
| Q |
120 |
gctattttggaagtttaaagaacaatatactttccacaaatgtagctgacatattcctacaactacgtaggaatatgacacattcatctccacctatg |
217 |
Q |
| |
|
||||||||| ||| |||||||||||||| |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45264658 |
gctattttgaaagcttaaagaacaatatgctttgcacaaatgcagctgacatattcctacaactacgtaggaatatgacacattcatctccacctatg |
45264561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 65 - 106
Target Start/End: Complemental strand, 46896252 - 46896211
Alignment:
| Q |
65 |
cgaacgatagttaactaccgttgaagataaaatgatcaattt |
106 |
Q |
| |
|
||||||||||||||||| ||||| ||||| |||||||||||| |
|
|
| T |
46896252 |
cgaacgatagttaactatcgttggagatagaatgatcaattt |
46896211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University