View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16845_low_22 (Length: 224)
Name: NF16845_low_22
Description: NF16845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16845_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 23987298 - 23987087
Alignment:
| Q |
1 |
ccatcctcccaccggcacagcaaccgtgttgcgaattgaaggattcaccaaattatacttgagtttatctgtagtaggattgaaaatcccgaagtcttgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
23987298 |
ccatcctcccaccggcacagcaaccgtgttgcgaattgaaggattcaccaaattatacttgagtttatcagtagtaggattgaaaatcccgaagtcttgc |
23987199 |
T |
|
| Q |
101 |
gccaaaacatgaaaattcataccatgaagatgcatgggatgactttgcgcattcaaaatcgctgtattttgaaacacaatctccaccgttgaattgtatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23987198 |
gccaaaacatgaaaattcataccatgaagatgcatgggatgactttgcgcattcaaaatcgctgtattttgaaacacaatctccaccgttgaattgtatt |
23987099 |
T |
|
| Q |
201 |
tgaattgcttca |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
23987098 |
tgaattgcttca |
23987087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 19743759 - 19743635
Alignment:
| Q |
1 |
ccatcctcccaccggcacagcaaccgtgttgcgaattgaaggattcaccaaattatacttgagtttatctgtagtaggattgaaaatcccgaagtcttgc |
100 |
Q |
| |
|
|||||||||| |||||| || || | |||||||||| |||||||||| |||||||||||||||||| ||| |||| |||||||| | | |||||| |
|
|
| T |
19743759 |
ccatcctcccgccggcaaagaaatcacgttgcgaattataggattcacc---ttatacttgagtttatctctagcaggaatgaaaatctccaggtcttga |
19743663 |
T |
|
| Q |
101 |
gccaaaacatgaaaattcataccatgaa |
128 |
Q |
| |
|
||||||||||| |||||||||||||||| |
|
|
| T |
19743662 |
gccaaaacatgtaaattcataccatgaa |
19743635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University