View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16845_low_23 (Length: 216)
Name: NF16845_low_23
Description: NF16845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16845_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 8e-94; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 16 - 197
Target Start/End: Complemental strand, 32126450 - 32126269
Alignment:
| Q |
16 |
acagaacaatgtgatttggagcatgtttggtgcaaattcgatggtgaatataaatgatgaggttttgtgtcttggatttgttaacggtggtctgaaccta |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32126450 |
acagaacaatgtgatttggagcatgtttggtgcaaattcgatggtgaatataaatgatgaggttttgtgtcttggatttgttaacggtggtgtgaaccta |
32126351 |
T |
|
| Q |
116 |
aggacttctattgtgattggagggtatcaattggagaataatcttttgcaatttgatttggctgcgtctagattgggtttta |
197 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32126350 |
aggacttctattgtgattggagggtatcagttggagaataatcttttgcaatttgatttggctgcgtctagattgggtttta |
32126269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 17 - 197
Target Start/End: Complemental strand, 32147646 - 32147466
Alignment:
| Q |
17 |
cagaacaatgtgatttggagcatgtttggtgcaaattcgatggtgaatataaatgatgaggttttgtgtcttggatttgttaacggtggtctgaacctaa |
116 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| | |||||| ||| | |
|
|
| T |
32147646 |
cagaacaatgtgatttggaggatatttggtgcaaattcaatggtgaatataaatgatgaggttttgtgtcttggttttgtgattggtggtgagaatacat |
32147547 |
T |
|
| Q |
117 |
ggacttctattgtgattggagggtatcaattggagaataatcttttgcaatttgatttggctgcgtctagattgggtttta |
197 |
Q |
| |
|
|| |||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |||||| |||| |
|
|
| T |
32147546 |
gggcttcaattgtgattggagggtatcagttggagaataatcttttgcaatttgatttggctgcttctaaattgggattta |
32147466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 23 - 197
Target Start/End: Complemental strand, 32138247 - 32138073
Alignment:
| Q |
23 |
aatgtgatttggagcatgtttggtgcaaattcgatggtgaatataaatgatgaggttttgtgtcttggatttgttaacggtggtctgaacctaaggactt |
122 |
Q |
| |
|
|||||| ||||||| || |||||||||||||| ||||||| |||||||||||| |||||||||||||||||||| || |||||| ||| |||||||| |
|
|
| T |
32138247 |
aatgtggtttggaggatatttggtgcaaattcaatggtgagtataaatgatgaagttttgtgtcttggatttgtgaatggtggtaagaatacaaggactt |
32138148 |
T |
|
| Q |
123 |
ctattgtgattggagggtatcaattggagaataatcttttgcaatttgatttggctgcgtctagattgggtttta |
197 |
Q |
| |
|
| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |||||| |||| |
|
|
| T |
32138147 |
caattgtgattggagggtatcagttggagaataatcttttgcaatttgatttggctgcttctaaattgggattta |
32138073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 141 - 178
Target Start/End: Complemental strand, 33777391 - 33777354
Alignment:
| Q |
141 |
atcaattggagaataatcttttgcaatttgatttggct |
178 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
33777391 |
atcaattggagaataatttgttgcaatttgatttggct |
33777354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University