View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16845_low_24 (Length: 211)
Name: NF16845_low_24
Description: NF16845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16845_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 21 - 195
Target Start/End: Complemental strand, 30255587 - 30255413
Alignment:
| Q |
21 |
tgtgcgtctagattgtccgatcaaaatcagacggtccgtatttcaattctgattttgatttcttttaaatttaaaatagccagcttaaaagttaaaccgt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30255587 |
tgtgcgtctagattgtccgatcaaaatcagacggtccgtatttcaattctgattttgatttcttttaaatttaaaatagcgagcttaaaagttaaaccgt |
30255488 |
T |
|
| Q |
121 |
ttaatcttgatcaaacagttcagaagtgactgactgcatgaggttataggattattactacacactacccctatg |
195 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30255487 |
ttaatcttgatcaaacagttcaaaagtgactgactgcatgaggttataggattattactacacactacccctatg |
30255413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University