View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16846_low_1 (Length: 247)
Name: NF16846_low_1
Description: NF16846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16846_low_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 13 - 239
Target Start/End: Complemental strand, 21784205 - 21783972
Alignment:
| Q |
13 |
catcacaatgtatggctactttattgctatttc-------attgttattatttatattctgacatctacaactgtcttttagggagctttggtgatatta |
105 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21784205 |
catcacaatgtacggctactttattgctatttcgttgttaattgttattatttatattctgacatctacgactgtcttttagggagctttggtgatatta |
21784106 |
T |
|
| Q |
106 |
acatggcaggagtgggagctgatgagggaagaaatatttgtgactttgaaacatgtgatgtgtctgacttctacatttctgacatgatcattacaagctt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21784105 |
acatggcaggagtgggagctgatgagggaagaaatatttgtgactttgaaacatgtgatgtgtctgacttctacatttctgacatgatcattacaagctt |
21784006 |
T |
|
| Q |
206 |
acccttttgtggaaattcattggatgatgatgtc |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
21784005 |
acccttttgtggaaattcattggatgatgatgtc |
21783972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University