View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16848_low_1 (Length: 303)
Name: NF16848_low_1
Description: NF16848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16848_low_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 21 - 294
Target Start/End: Complemental strand, 45211934 - 45211661
Alignment:
| Q |
21 |
tgtatatcactctacaatactcccactcaaaagttgcaagaaatgataatatcacatctcagtgatctcctcacacataaaatgatcacacacacattcc |
120 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45211934 |
tgtatatcactctacaatactcctactcaagagttgcaagaaatgataatatcacatctcagtgatctcctcacacataaaatgatcacacacacattcc |
45211835 |
T |
|
| Q |
121 |
tctctagacattgttggcgatacatccactcttcacatgatcaaggttggggatgcttcaacttttcacaggtttccttagttacaggacgggatgagac |
220 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45211834 |
tctctatacattgttggcgatacatccactcttcacatggtcaaggttggggatgcttcaacttttcacaggtttccttggttacaggacgggatgagac |
45211735 |
T |
|
| Q |
221 |
tctcgttcatgaatatagcatacatagtggacattattatcccacattttcaagtagcttgacttcatctctct |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45211734 |
tctcgttcatgaatatagcatacatagtggacattattatcccacattttcaagtagcttgacttcatttctct |
45211661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University