View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1684_low_18 (Length: 223)

Name: NF1684_low_18
Description: NF1684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1684_low_18
NF1684_low_18
[»] chr4 (1 HSPs)
chr4 (109-204)||(44003976-44004071)


Alignment Details
Target: chr4 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 109 - 204
Target Start/End: Original strand, 44003976 - 44004071
Alignment:
109 catagaggatatcccaagataatgatgtagtagaaaggatggtgaatgtaatcagcaaaagtagaggctacagtatgaccaccaaaaagagagaca 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44003976 catagaggatatcccaagataatgatgtagtagaaaggatggtgaatgtaatcagcaaaagtagaggctacagtatgaccaccaaaaagagagaca 44004071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University