View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1684_low_4 (Length: 366)
Name: NF1684_low_4
Description: NF1684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1684_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 14 - 223
Target Start/End: Complemental strand, 50177190 - 50176973
Alignment:
| Q |
14 |
taattacgtgtgtgttaaaataataaataagtggttgacctggatgatgtcaatctgattattaagattggatatggcaactttcatcctatgcttccct |
113 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50177190 |
taattatgtgtgtgttaaaataataaataagtggttgacctggatgatgtcaatctgattattaagattggatatggcaactttcatcctatgcttccct |
50177091 |
T |
 |
| Q |
114 |
agaaaccaaaagctcctgtttgtgccataagatgaagaaccttttccccttctcctttgaagtc-----------ttctgctcctgtttgaggcaaaggt |
202 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
50177090 |
agaaacc--aagctcctgtttgtgccataagatgaagaaccttttccccttctcctttgaagtcttctggtactattctgctcctgtttgaggc-aaggt |
50176994 |
T |
 |
| Q |
203 |
ggtgggtgcaatttttctgtt |
223 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
50176993 |
ggtgggtgcaatttttctgtt |
50176973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University